May 2009 BLOG

BLOG index
Apr 2009
Jun 2009

2009-05-31 Escher: Unescapable, or unduplicable?

Was idling with blocking parts of my vision and scanning the room when I turned the gaze towards an Escher picture and noticed that the last 3 letters are HER. What are the first 3 letters? ESC. That reminded me of escape. So just completed the ESC with APE. Then I started playing around with those letters. ESCAPE HER. APE ESCHER. What else can one do? ACE SPHERE! Also SHEER PACE. And HERE SPACE.

By then I decided that there must be a place where they give you all the anagrams and I looked for one and found the Internet Anagram Server. Neat. They have over 200 anagrams for ape escher, mostly nonsensical, but over a dozen are great.

2009-05-21 Human Accelerated Region 1 (HAR1)

With gene sequencing and comparisons between different species, especially humans and relatively proximate species, it is becoming possible to understand what makes us human i.e. why we seem to be the culmination of biological evolution in this tiny part of the universe. The fact that we have been mostly evolving outside now is another story. The May 2009 Scientific American carries an article on HAR1, a small number of bases on Chromosome 20 that may hold a key to our brain development. It makes good reading. Many online tools now allow you to browse genes. Blat is one such. Typing these 20 bases in Blat shows how they look compared to several other species: TGAAACGGAGGAGACGTTAC

Interestingly, typing that sequence in Google brings up nothing (since it does not appear - yet- in any documents explicitly). But typing it in WolframAlpha does tell you that it is from HAR1! Unfortunately you can not do anything beyond that at this point.

2009-05-20 Tropical Maths

Attended a talk by Bernd Sturmfels on Tropical Maths. Seems fun. You define Tropical plus as min, as tropical multiply as add and you can do lots of things. Zeroes are interesting and so are polynomials. In fact one can do a great deal. Analogs for many theorems exist, and several are easier in some sense. Bernd mentioned Pappus theorem and how papers which both prove and disprove it exist. It was fun. Had to leave halfway as had other work, and also it was starting to become jargony.


BLOG index
Apr 2009
Jun 2009